Showing posts with label nucleotide. Show all posts
Showing posts with label nucleotide. Show all posts

Tuesday, December 15, 2009

Macau 2001: Composition & Structure of DNA



I started my collection for this theme with this set from Macau (Scott 1076 & 1077), issued 9 October 2001. It comprises a souvenir sheet and 4 stamps from the Science & Technology Series, with the theme of Composition & Structure of DNA. Each of the 4 stamps features, respectively one of the 4 nucleotides, that form basis of DNA: 1p guanine (G), 2p cytosine (C), 3p adenine (A), and 4p thymine (T). The souvenir sheet shows how the nucleotides are connected to form the helical structure of DNA; in the two strands of nucleotides that twist to form the DNA, adenine (A) can only link to thymine (T) in the opposite strand, and guanine (G) only to cytosine (C). When writing out a DNA sequence, one typically writes out only one strand, as the other strand could be easily figured out. For example in "Jurassic Park" by Michael Crichton, the first 20 DNA bases from which a dinosaur was cloned is written as:
GCGTTGCTGGCGTTTTTCCA

The other strand, also called the complementary strand would then be:
CGCAACGACCGCAAAAAGGT